Primers we Provide as Standard
Below is a table of all the primers that we provide free of charge. Just specify the primer on the sample submission form and we will use it. Plasmid / Primer compatibility information is also available.
| Primer Name | Primer Sequence (5'->3') | Comments |
| M13 Fwd (-20) | GTAAAACGACGGCCAGTG | (1) |
| M13 Rev | GGAAACAGCTATGACCATG | Works in all plasmids tried (2) |
| T7 | TAATACGACTCACTATAGGG | Works in all plasmids tried (3) |
| T7 Terminator | TATGCTAGTTATTGCTCAG | At 3' end of MCS within pET plasmids |
| New T3 | AATTAACCCTCACTAAAGGG | Works in all plasmids tried |
| New SP6 | AGCTATTTAGGTGACACTATAG | Check first, often doesn't work (4) |
| pGEX Fwd | CCAGCAAGTATATAGCATGG | Works in all plasmids tried (5) |
| pGEX Rev | CCGGGAGCTGCATGTGTCAGAGG | Works in all bacterial pGEX plasmids tried |
| pFastBac Fwd | TATTCCGGATTATTCATACCGTC | At 5' end of MCS within pFastBac-1 |
| pFastBac Rev | GTATGGCTGATTATGATCCTC | At 3' end of MCS within pFastBac-1 |
| pCMV5 Fwd | CGTTGACGCAAATGGGCGG | At 5' end of MCS within pCMV5 (6) |
| pCMV5 Rev | CCTCCACCCCATAATATTATAGAAGGACAC | At 3' end of MCS within pCMV5 |
| GAL4AD | AATACCACTACAATGGATGATGTAT | For use with Y2H library vectors (7) |
| GAL4BD | TCATCGGAAGAGAGTAGTAACAAAG | For use with Y2H bait vectors (7) |
| pLEXA-C-F | TTTCTGCACAATATTTCAAGC | For use with pLEXA-C bait vector (8) |
| pLEXA-C-R | ATGAGATCAAACACCTCTTG | For use with pLEXA-C bait vector (8) |
Notes:
1. This primer does NOT work with Invitrogen Gateway vectors (e.g. pDONR221) due to a base mismatch at the 3' end. Our primer contains a "G" at the extreme 3' end, but the Gateway plasmids possess a "C" at this position. For sequencing Gateway vectors, please either use the Invitrogen M13 (-20) primer (GTAAAACGACGGCCAG) or the Stratagene M13 (-20) primer (GTAAAACGACGGCCAGT).
2. There is a base deletion in some pUC18 vectors that results in the M13Rev primer not binding. Details of this deletion can be found in the New England Biolabs catalogue (p136 of the 2003 catalogue). If you use pUC18 you may wish to use a different primer in case your plasmid is affected.
3. We now have a single T7 primer that works in all the plasmids we have tried. This replaces both the "old T7" and "New T7" primers we previously had.
4. For SP6, we can only use the new primer since the old version does not work at all well for automated sequencing. However, many plasmids diverge outside the core SP6 promoter sequence (see below for examples) and so often will not work with the new primer. If you plan to use the New SP6, you MUST check your plasmid sequence.
5. This is a new version of the pGEX forward primer. It is a little further 5' than the one we were using. This primer will lead to less "contamination" of the sequence with dye terminators when certain pGEX plasmids are sequenced in which the multi-cloning site was near to the original priming site.
6. This primer should work in any vector that contains a CMV promoter. However, customers should check for compatibility before requesting this.
7. These primers are for yeast two hybrid bait and library vectors. Due to the increasing number of Y2H systems available, customers are advised to check their particular Y2H vectors to ensure that the primers will work before they ask us to use these primers.
8. These primers are for the Dualsystems DUALhybrid yeast two hybrid pLEXA-C bait vector. Note that these primers are not the correct primer for the pLEXA-N bait vector or the pGAD-HA library vector (however, the GAL4AD primer we have should work for the pGAD-HA vector).
Special Considerations
This list of primers is under constant review as we identify primers that are frequently used. Whilst we will always consider suggestions for primers that customers feel would be useful for us to add to the list, we will only provide primers that will be widely used.
The primers we provide free of charge for customer sequencing are checked thoroughly before use and we constantly monitor performance to check for any problems. Hence, we would encourage customers, whenever possible, to use these primers. However, we respect customers' wishes and so if you provide your own primer, we will not be offended and we will use the provided primer.
These primers are only for use with samples sent to us for DNA sequencing. We cannot provide these primers to customers for any other purpose.
