FESTIVE CLOSURE

Festive Closure

The service will close down over the festive period. We aim to process any sequencing samples arriving before or on the first post of Friday 22nd of December. Any sequencing samples arriving after that will be stored and processed on our return (3rd January). For other sample types please contact us.

Resources | Primers | Standard Primers

Primers are an integral part of all sequencing reactions and facilitate the acquisition of sequence information 3’ of their binding site. Many primers are commonly found within numerous plasmids in routine use throughout the molecular biology realm. DNA Sequencing and Services have identified many of these in order to assist customers with their sequencing needs. 

Below is a table of all the primers that we provide free of charge to all our customers.

Primer Name Primer Sequence (5'->3') Plasmid Specificity Comments
CMV Fwd CGCAAATGGGCGGTAGGCGTG At 5' end of MCS in pCMV5 (4) This is a "Universal" primer and should work in any vector that contains a CMV promoter. However, as with any primer, customers should still check for compatibility with their plasmid.
CMV Rev CCTCCACCCCATAATATTATAGAAGGACAC At 3' end of MCS in pCMV5  
M13 Fwd GTAAAACGACGGCCAGTG Common to many plasmids (-20 version) This primer does NOT work with Invitrogen Gateway vectors (e.g. pDONR221) due to a base mismatch at the 3' end. Our primer contains a "G" at the extreme 3' end, but the Gateway plasmids possess a "C" at this position. For sequencing Gateway vectors, please use the Gateway-specific primers we have.
M13 Fwd(GW) TGTAAAACGACGGCCAGT Specific for Gateway vectors  
M13 Rev GGAAACAGCTATGACCATG Common to many plasmids There is a base deletion in some pUC18 vectors that results in the M13Rev primer not binding. Details of this deletion can be found in the New England Biolabs catalogue (p136 of the 2003 catalogue). If you use pUC18 you may wish to use a different primer in case your plasmid is affected.
M13 Rev(GW) CAGGAAACAGCTATGACC Specific for Gateway vectors  
SP6 AGCTATTTAGGTGACACTATAG Common to many plasmids Many plasmids diverge outside the core SP6 promoter sequence. If you plan to use the SP6 primer, you MUST check your plasmid sequence to ensure the primer is compatible.
T3 AATTAACCCTCACTAAAGGG Common to many plasmids  
T7 TAATACGACTCACTATAGGG Common to many plasmids  
T7 Term TATGCTAGTTATTGCTCAG Common to many plasmids  
Bac Fwd TATTCCGGATTATTCATACCGTC At 5' end of MCS in pFastBac-1  
Bac Rev GTATGGCTGATTATGATCCTC At 3' end of MCS in pFastBac-1  
BGH Rev TAGAAGGCACAGTCGAGG For mammalian expression vectors (8) For sequencing from the 3' end of mammalian expression vectors containing the BGH polyadenylation signal.
DuetDOWN1 GATTATGCGGCCGTGTACAA For pETDuet, pACYCDuet vectors (7) These primers work in the Duet vectors for co-expression of proteins. DuetDOWN1 gives a reverse read of T7 transcription start-1 MCS. DuetUP2 gives a forward read of T7 transcription start-2 MCS.
DuetUP2 TTGTACACGGCCGCATAATC For pETDuet, pACYCDuet vectors (7) These primers work in the Duet vectors for co-expression of proteins. DuetDOWN1 gives a reverse read of T7 transcription start-1 MCS. DuetUP2 gives a forward read of T7 transcription start-2 MCS.
GAL4AD AATACCACTACAATGGATGATGTAT For Y2H library vectors (5) These primers are for yeast two hybrid bait and library vectors. Due to the increasing number of Y2H systems available, customers are advised to check their particular Y2H vectors to ensure that the primers will work before they ask us to use these primers.
GAL4BD TCATCGGAAGAGAGTAGTAACAAAG For Y2H bait vectors (5) These primers are for yeast two hybrid bait and library vectors. Due to the increasing number of Y2H systems available, customers are advised to check their particular Y2H vectors to ensure that the primers will work before they ask us to use these primers.
Mal Fwd GGTCGTCAGACTGTCGATGAAGCC Present in plasmids such as: pMALp2x,pMal4CE  
Mal Rev AATCTTATCTCATCCGCCAAAACAGCCAAG Present in plasmids such as:  plasmids pMALp2x,pMal4CE   
p10 Fwd CCTTTAATTCAACCCAACACAATATATTATAGTTAAATAAGAATTATTAT For pFBDual vector  
p10 Rev CAAACGACCCAACACCCGTGCG For pFBDual vector  
pACT Fwd GGATGATGTATATAACTATCTATTCGATGATGAAGATAC For pACT2 Y2H vector  
pACT Rev GGCAAAACGATGTATAAATGAAAGAAATTGAGATGG For pACT2 Y2H vector  
pAS Fwd CTGATATGCCTCTAACATTGAGACAGCATAG For pAS2-1 Y2H vector  
pAS Rev AATAAGAGCGACCTCATGCTATACCTGAG For pAS2-1 Y2H vector  
pBABE Fwd CCTCCTCTTCTTCCATCC For pBABE puro, pBABE neo vectors  
pBABE Rev CCACACCTGGTTGCTGACTAATTGAG For pBABE puro, pBABE neo vectors  
pcDNA5 Rev CACCTACTCAGACAATGCGATGCAA For pcDNA5- and pcDNA3-based plasmids  
pEGFP-C1 CATGGTCCTGCTGGAGTTCGTGAC For pEGFPC1/2/3 vector  
pEGFP-Cter CCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTG For pEGFPC1/2/3 vector  
pEGFP-N1R GGCCGTTTACGTCGCCGTCC For pEGFP-N1 vector  
pET Upstream ATGCGTCCGGCGTAGA For pETDuet, pACYCDuet vectors (7) These primers work in the Duet vectors for co-expression of proteins. DuetDOWN1 gives a reverse read of T7 transcription start-1 MCS. DuetUP2 gives a forward read of T7 transcription start-2 MCS.
pGEX Fwd CCAGCAAGTATATAGCATGG Common to pGEX plasmids  
pGEX Rev CCGGGAGCTGCATGTGTCAGAGG Common to pGEX plasmids  
pLEXA-C-F TTTCTGCACAATATTTCAAGC For pLEXA-C bait vector (6) These primers are for the Dualsystems DUALhybrid yeast two hybrid pLEXA-C bait vector. Note that these primers are not compatible with the pLEXA-N bait vector or the pGAD-HA library vector (however, the GAL4AD primer we have should work for the pGAD-HA vector).
pLEXA-C-R ATGAGATCAAACACCTCTTG For pLEXA-C bait vector (6) These primers are for the Dualsystems DUALhybrid yeast two hybrid pLEXA-C bait vector. Note that these primers are not compatible with the pLEXA-N bait vector or the pGAD-HA library vector (however, the GAL4AD primer we have should work for the pGAD-HA vector).
pmCherryC1-F GTTGGACATCACCTCCCACAACGAG For pmCherry-C1 vector (9) For sequencing mCherry vectors. mCherry-C1-Fwd sequences from within the 3' end of the Cherry ORF and into the MCS (C-terminal fusion vector). mCherry-N1-Rev sequences back into the MCS from the 5' end of the ORF (N-terminal fusion vector).
pmCherryN1-R GGGGCGGCCCTCGCCCTCGCCCTCG For pmCherry-N1 vector (9) For sequencing mCherry vectors. mCherry-C1-Fwd sequences from within the 3' end of the Cherry ORF and into the MCS (C-terminal fusion vector). mCherry-N1-Rev sequences back into the MCS from the 5' end of the ORF (N-terminal fusion vector).
LKO.1 GACTATCATATGCTTACCGT Human U6 promoter 5' For sequencing inserts in plasmids that use the U6 promotor to synthesise short shRNA, siRNA, gDNA (CRISPR), etc sequences. Check that your plasmid is compatible!

 

The list provided is under constant review so customers can feel free to suggest additional primers that may be useful. Our staff will review these suggestions. Please note that any new additions to the list of primers will take into consideration those that will be most widely used by the research community at large.

 

Special Considerations

As a reminder, our various standard primers indicated above, are available to customers free of charge! 

Please note that when selecting any of our standard primers, it is critical to check that they are compatible with your template! Additional details regarding compatibility with commonly used vectors for molecular biology and biochemistry can be found on our Compatibility with Common Plasmids page.  

Do you need any help? Please get in touch and we’ll be happy to lend a hand.